After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
USH1CcDNA Clone Product Information
Gene_bank_ref_id:NM_005709.2
cDNA Size:1659
cDNA Description:ORF Clone of Homo sapiens Usher syndrome 1C (autosomal recessive, severe), transcript variant 1 DNA.
Gene Synonym:PDZ73, AIE-75, DFNB18, PDZ-45, PDZ-73, NY-CO-37, NY-CO-38, ush1cpst, PDZ-73/NY-CO-38
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10613-ACG$345
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10613-ACR$345
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10613-ANG$345
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10613-ANR$345
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10613-CF$315
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10613-CH$315
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10613-CM$315
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10613-CY$315
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10613-M$195
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10613-M-F$395
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10613-NF$315
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10613-NH$315
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10613-NM$315
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10613-NY$315
Human USH1C transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10613-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Harmonin, also known as Antigen NY-CO-38 / NY-CO-37, Autoimmune enteropathy-related antigen AIE-75, Protein PDZ-73, Renal carcinoma antigen NY-REN-3, Usher syndrome type-1C protein and USH1C, is a protein which is expressed in small intestine, colon, kidney, eye and weakly in pancreas. USH1C is expressed also in vestibule of the inner ear. USH1C contains 3 PDZ (DHR) domains. USH1C may be involved in protein-protein interaction. Defects in USH1C are the cause of Usher syndrome type 1C (USH1C), also known as Usher syndrome type I Acadian variety. USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa and sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). Defects in USH1C are also the cause of deafness autosomal recessive type 18 (DFNB18) which is a form of sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

References
  • Verpy, E. et al., 2000, Nat Genet. 26 (1):51-5.
  • Weil D., et al., 2003, Hum. Mol. Genet. 12:463-471.
  • Reiners,J. et al., 2005, Hum Mol Genet. 14 (24):3933-43.
  • Yan,D. et al., 2006, Mol Biol. 357 (3):755-64.
  • Size / Price
    Catalog:HG10613-NH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"