After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Canine NOV ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Canine NOV cDNA Clone Product Information
NCBI RefSeq:XM_532317.3
RefSeq ORF Size:1062bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris nephroblastoma overexpressed gene with C terminal HA tag.
Gene Synonym:NOV
Species:Canine
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

Protein NOV homolog, also known as Nephroblastoma-overexpressed gene protein homolog, NOV, and CCN3, is a putative ligand for integrin receptors, is tightly associated with the extracellular matrix and mediates diverse cellular functions, including cell adhesion and proliferation. CCN3 has been shown to negatively regulate growth although it promotes migration in a cell type-specific manner. This secreted protein belongs to the CCN family, and its expression was observed in a broad variety of tissues from the early stage of development , and altered expression of CCN3 has been observed in a variety of tumors, including hepatocellular carcinomas, Wilm's tumors, Ewing's sarcomas, gliomas, rhabdomyosarcomas, and adrenocortical carcinomas. Mature CCN3 protein has five distinct modules and truncated protein variants with altered function are found in many cancers. CCN3 acts through the core stem cell signalling pathways including Notch and Bone Morphogenic Protein, connecting CCN3 with the modulation of self-renewal and maturation of a number of cell lineages including hematopoietic, osteogenic and chondrogenic. CCN3 may affect the extracellular environment of the niche for hematopoietic stem cells. CCN3 has emerged as a key player in stem cell regulation, hematopoiesis and a crucial component within the bone marrow microenvironment.

References
  • Manara MC, et al. (2002) The expression of ccn3(nov) gene in musculoskeletal tumors. Am J Pathol. 160(3): 849-59.
  • Lin CG, et al. (2003) CCN3 (NOV) is a novel angiogenic regulator of the CCN protein family. J Biol Chem. 278(26): 24200-8.
  • Vallacchi V, et al. (2009) CCN3/nephroblastoma overexpressed matricellular protein regulates integrin expression, adhesion, and dissemination in melanoma. Cancer Res. 68(3): 715-23.
  • Sin WC, et al. (2009) Matricellular protein CCN3 (NOV) regulates actin cytoskeleton reorganization. J Biol Chem. 284(43): 29935-44.
  • McCallum L, et al. (2009) CCN3--a key regulator of the hematopoietic compartment. Blood Rev. 23(2): 79-85.
  • Size / Price
    Catalog: DG70043-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeks
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"