Quick Order

Text Size:AAA

Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTPN2cDNA Clone Product Information
cDNA Size:1164
cDNA Description:ORF Clone of Homo sapiens protein tyrosine phosphatase, non-receptor type 2, transcript variant 2 DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10571-ACG$325
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10571-ACR$325
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10571-ANG$325
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10571-ANR$325
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10571-CF$295
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10571-CH$295
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10571-CM$295
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10571-CY$295
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10571-M$95
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10571-M-F$295
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10571-M-N$295
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10571-NF$295
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10571-NH$295
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10571-NM$295
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10571-NY$295
Human PTPN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10571-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Tyrosine-protein phosphatase non-receptor type 2, also known as T-cell protein-tyrosine phosphatase, PTPN2 and PTPT, is a cytoplasm protein which belongs to the protein-tyrosine phosphatase family and Non-receptor class 1 subfamily. Members of the protein tyrosine phosphatase ( PTP ) family share a highly conserved catalytic motif, which is essential for the catalytic activity. TC-PTP / PTPN2 is a cytosolic tyrosine phosphatase that functions as a negative regulator of a variety of tyrosine kinases and other signaling proteins. The expression of TC-PTP / PTPN2 plays a role of tumor suppressor and may modulate response to treatment. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. TC-PTP / PTPN2 is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. TC-PTP / PTPN2 was identified as a negative regulator of NUP214-ABL1 kinase activity.