After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TGFBI Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TGFBIcDNA Clone Product Information
cDNA Size:2052
cDNA Description:ORF Clone of Homo sapiens transforming growth factor, beta-induced, 68kDa DNA.
Gene Synonym:CSD, CDB1, CDG2, CSD1, CSD2, CSD3, EBMD, LCD1, BIGH3, CDGG1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

TGFBI is an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. TGFBI plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. TGFBI is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in TGFBI are associated with multiple types of corneal dystrophy. TGFBI can bind to type I, II, and IV collagens. This adhesion protein may play an important role in cell-collagen interactions. In cartilage, TGFBI may be involved in endochondral bone formation. Loss of the TGFBI is sufficient to induce specific resistance.

  • Kannabiran C, et al. (2006) TGFBI gene mutations in corneal dystrophies. Hum Mutat. 27(7): 615-25.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items