After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AREG Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AREGcDNA Clone Product Information
cDNA Size:759
cDNA Description:ORF Clone of Homo sapiens amphiregulin DNA.
Gene Synonym:AR, SDGF, CRDGF, MGC13647
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Epidermal Growth Factor (EGF) & Receptor Related Products
Product nameProduct name
Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinHuman NRG1 Protein (His Tag, ECD)Canine NRG1-alpha Protein (ECD)Mouse EGFL6 / EGF-L6 Protein (His Tag)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinMouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman HER3 / ErbB3 ProteinRhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human HBEGF / DTR ProteinHuman / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human EGF / Epidermal Growth Factor ProteinHuman Epiregulin / EREG Protein (Fc Tag) Human EGFL6 / EGF-L6 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman BTC / Betacellulin Protein (Fc Tag)Human BTC / Betacellulin ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Mouse EGFL7 / VE-statin Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinMouse EGF / Epidermal Growth Factor ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Canine HER2 / ErbB2 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Mouse HER4 / ErbB4 Protein (His Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Rat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rat HER2 / ErbB2 ProteinRat EGFR / HER1 / ErbB1 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)

Amphiregulin(AREG), also known as colorectum cell-derived growth factor, CRDGF, SDGF and AREG, is a member of the epidermal growth factor family and the amphiregulin family. Members of EGF family are cytokines that include 10 proteins such as EGF, TGFb, HBEGF, and the various heregulins. Amphiregulin is a single-pass membrane protein and contains one EGF-like domain. It plays a key role in epithelial development in various organs. Amphiregulin has a realationship with epidermal growth factor (EGF) and transforming growth factor alpha (TGF-alpha). It is an autocrine growth factor as well as a mitogen for astrocytes, Schwann cells, and fibroblasts. As a bifunctional growth-modulating glycoprotein, amphiregulin inhibits growth of several human carcinoma cells in culture and stimulates proliferation of human fibroblasts and certain other tumor cells. Amphiregulin also may play a protective role in bleomycin-induced pneumopathy, probably through the activation of survival signals.

  • Shoyab M, et al. (1989) Structure and function of human amphiregulin: a member of the epidermal growth factor family. Science. 243 (4894): 1074-6.
  • Plowman GD, et al. (1990) The amphiregulin gene encodes a novel epidermal growth factor-related protein with tumor-inhibitory activity. Mol Cell Biol. 10 (5): 1969-81.
  • Culouscou JM, et al. (1993) Colorectum cell-derived growth factor (CRDGF) is homologous to amphiregulin, a member of the epidermal growth factor family. Growth Factors. 7 (3): 195-205.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items