Quick Order

Human AHSP / ERAF Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AHSPcDNA Clone Product Information
cDNA Size:309
cDNA Description:ORF Clone of Homo sapiens erythroid associated factor DNA.
Gene Synonym:EDRF, ERAF, AHSP
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human AHSP / ERAF Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Related Products
Product nameProduct name

AHSP, also known as ERAF, is a conserved mammalian erythroid protein which belongs to the AHSP family. It is expressed in blood and bone marrow. AHSP facilitates the production of Hemoglobin A by stabilizing free α-globin. It rapidly binds to ferrous α with association (k'(AHSP)) and dissociation (k(AHSP)) rate constants of ≈10 μm(-1) s(-1) and 0.2 s(-1), respectively, at pH 7.4 at 22 ℃. A small slow phase was observed when AHSP binds to excess ferrous αCO. This slow phase appears to be due to cis to trans prolyl isomerization of the Asp(29)-Pro(30) peptide bond in wild-type AHSP because it was absent when αCO was mixed with P30A and P30W AHSP, which are fixed in the trans conformation. This slow phase was also absent when met(Fe(3+))-α reacted with wild-type AHSP, suggesting that met-α is capable of rapidly binding to either Pro(30) conformer. Both wild-type and Pro(30)-substituted AHSPs drive the formation of a met-α hemichrome conformation following binding to either met- or oxy(Fe(2+))-α. The dissociation rate of the met-α·AHSP complex (k(AHSP) ≈ 0.002 s(-1)) is ~100-fold slower than that for ferrous α·AHSP complexes, resulting in a much higher affinity of AHSP for met-α. Thus, in vivo, AHSP acts as a molecular chaperone by rapidly binding and stabilizing met-α hemichrome folding intermediates. The low rate of met-α dissociation also allows AHSP to have a quality control function by kinetically trapping ferric α and preventing its incorporation into less stable mixed valence Hemoglobin A tetramers. Reduction of AHSP-bound met-α allows more rapid release to β subunits to form stable fully, reduced hemoglobin dimers and tetramers.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items