Quick Order

Human GUCA1A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GUCA1AcDNA Clone Product Information
cDNA Size:606
cDNA Description:ORF Clone of Homo sapiens guanylate cyclase activator 1A (retina) DNA.
Gene Synonym:COD3, GCAP, GUCA, GCAP1, GUCA1, CORD14, C6orf131, dJ139D8.6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

GCAP 1 gene plays a role in the recovery of retinal photoreceptors from photobleaching. In the recovery phase, the phototransduction messeneger cGMP is replenished by retinal guanylyl cyclase-1 (GC1). GC1 is activated by decreasing Ca(2+) concentrations following photobleaching. The protein encoded by this gene, guanylyl cyclase activating protein 1 (GCAP 1), mediates the sensitivity of GC1 to Ca(2+) concentrations. GCAP 1 promotes activity of GC1 at low Ca(2+) concentrations and inhibits GC1 activity at high Ca(2+) concentrations. Mutations in GCAP 1 gene cause autosomal dominant cone dystrophy (COD3); a disease characterized by reduced visual acuity associated with progressive loss of color vision. GCAP 1 stimulates guanylyl cyclase 1 (GC1) when free calcium ions concentration is low and inhibits GC1 when free calcium ions concentration is elevated. This Ca(2+)-sensitive regulation of GC is a key event in recovery of the dark state of rod photoreceptors following light exposure.

  • Surguchov A, et al. (1997) The human GCAP1 and GCAP2 genes are arranged in a tail-to-tail array on the short arm of chromosome 6 (p21.1). Genomics. 39(3):312-22.
  • Subbaraya I, et al. (1995) Molecular characterization of human and mouse photoreceptor guanylate cyclase-activating protein (GCAP) and chromosomal localization of the human gene. J Biol Chem. 269(49):31080-9.
  • Payne AM, et al. (1998) A mutation in guanylate cyclase activator 1A (GCAP 1) in an autosomal dominant cone dystrophy pedigree mapping to a new locus on chromosome 6p21.1. Hum Mol Genet. 7(2):273-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items