Quick Order

Human ENO1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ENO1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001428.2
RefSeq ORF Size:1305bp
cDNA Description:Full length Clone DNA of Homo sapiens enolase 1, (alpha) with C terminal His tag.
Gene Synonym:NNE, PPH, MPB1, MBP-1, ENO1L1, ENO1
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-ENO1-His
Restriction Site:KpnI + XbaI (6kb + 1.35kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1296G/A and 1302G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Catalog: HG11554-CH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"