Quick Order

Human VSIG2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VSIG2 cDNA Clone Product Information
Gene_bank_ref_id:NM_014312.3
RefSeq ORF Size:984bp
cDNA Description:Full length Clone DNA of Homo sapiens V-set and immunoglobulin domain containing 2 with C terminal His tag.
Gene Synonym:CTH, CTXL, 2210413P10Rik, VSIG2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

V-set and immunoglobulin domain-containing protein 2, also known as cortical thymocyte-like protein, CT-like protein and VSIG2, is a single-pass type I membrane protein which contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. VSIG2 is highly expressed in stomach, colon, prostate, trachea and thyroid glands and weakly in bladder and lung. V-set domains are Ig-like domains resembling the antibody variable domain. V-set domains are found in diverse protein families, including immunoglobulin light and heavy chains; in several T-cell receptors such as CD2 (Cluster of Differentiation 2), CD4, CD80, and CD86; in myelin membrane adhesion molecules; in junction adhesion molecules (JAM); in tyrosine-protein kinase receptors; and in the programmed cell death protein 1 (PD1).

References
  • Satow Y, et al.,1986, J. Mol. Biol. 190(4): 593-604. 
  • Kariuki,S.N. et al., 2010, Arthritis Res Ther. 12 (4):R151.
  • Size / Price
    Catalog: HG11543-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"