Quick Order

Text Size:AAA

Human PAPPA2 transcript variant 1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PAPPA2 cDNA Clone Product Information
Gene_bank_ref_id:NM_020318.2
RefSeq ORF Size:5376bp
cDNA Description:Full length Clone DNA of Homo sapiens pappalysin 2 , transcript variant 1 with N terminal His tag.
Gene Synonym:PAPPE, PLAC3, PAPP-A2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Pappalysin-2/PAPP-A2 is the second member of the pappalysin family of metzincin superfamily, of which PAPP-A is the first member. There is no homology between the prepro-peptides of PAPP-A and PAPP-A2, but 46% of the residues of mature PAPP-A are also present in mature PAPP-A2. PAPP-A specifically cleaves insulin-like growth factor-binding protein(IGFBP)-4, one of six known modulators of IGF-I and –II, whereas PAPP-A2 specifically cleaved IGFBP-5 at one site, between Ser-143 and Lys-144. In contrast to the cleavage of IGFBP-4 by PAPP-A that strictly requires the presence of IGF, the cleavage of IGFBP-5 by PAPP-A2 was IGF-independent. Recent data firmly establish PAPP-A and IGFBP-4 as an important functional pair in several systems. Because of its close relationship with PAPP-A, both structurally and functionally, PAPP-A2 is a likely candidate for IGFBP-5 proteinase in many tissues and conditioned media where IGFBP-5 proteolysis has been reported.

References
  • Lisbeth S Laursen. et al., 2002, Vol. 277 (49): 47225-34.
  • Michael T Overgaard. et al., 2001, The Journal of Biological Chemistry. 276 (24): 21849-53.
  • Size / Price
    Catalog: HG10528-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"