After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human METTL1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human METTL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_005371.5
RefSeq ORF Size:831bp
cDNA Description:Full length Clone DNA of Homo sapiens methyltransferase like 1 with C terminal His tag.
Gene Synonym:TRM8, C12orf1, YDL201w, FLJ95748, METTL1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

tRNA (guanine-N(7)-)-methyltransferase, also known as Methyltransferase-like protein 1, tRNA (m7G46)-methyltransferase and METTL1, is a nucleus protein which belongs to the methyltransferase superfamily and TrmB family. METTL1 gene, has been identified by its sequence similarity to the yeast ORF YDL201w. The human cDNA and the genomic structure of METTL1 have been analyzed. The transcript contains 1292 nucleotides and codes for a protein of 276 amino acids. The METTL1 gene product shows high sequence similarities to putative proteins from mouse, Drosophila melanogaster, Arabidopsis thaliana, Caenorhabditis elegans, and yeast (39.8% identity between all six species). Computer analyses of the deduced protein sequence reveal two highly conserved amino acid motifs, one of which is typical for methyltransferases. Both motifs are also present in hypothetical proteins from eubacteria. Disruption of the homologous yeast ORF YDL201w shows that the gene is at least not essential for vegetative growth in Saccharomyces cerevisiae.

References
  • Bahr, A.et al., 1999, Genomics. 57 (3):424-8.
  • Wikman, H. et al., 2005,Genes Chromosomes Cancer. 42 (2):193-9.
  • Cartlidge, RA. et al., 2005, EMBO J. 24 (9):1696-705.
  • Size / Price
    Catalog: HG11525-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"