Quick Order

Text Size:AAA

Human FKBP14 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FKBP14 cDNA Clone Product Information
Gene_bank_ref_id:NM_017946.2
RefSeq ORF Size:636bp
cDNA Description:Full length Clone DNA of Homo sapiens FK506 binding protein 14, 22 kDa with N terminal Myc tag.
Gene Synonym:FKBP22, FLJ20731, FKBP14
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

FKBP14 belongs to the FK506-binding protein family. It contains 2 EF-hand domains and one PPIase FKBP-type domain. FKBP14 can be detected in the lumen of the endoplasmic reticulum where it is thought to accelerate the folding of proteins during protein synthesis. Truncation of the amino-terminus of FKBP14 significantly decreases peptidyl prolyl cis-trans isomerase activity, therefore implicating that the PPIase FKBP-type domain must be located at the N-terminus. Defects in FKBP14 can cause Ehlers-Danlos syndrome with progressive kyphoscoliosis, myopathy, and hearing loss. A syndrome with features of Ehlers-Danlos syndrome types VIA and VIB on the one hand, and the collagen VI-related congenital myopathies Ullrich congenital muscular dystrophy and Bethlem myopathy on the other hand.

References
  • Baker K, et al. (2003) The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. Genome Res. 13:2265-70.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36:40-5.
  • The MGC Project Team. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14:2121-7.
  • Size / Price
    Catalog: HG13522-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"