Quick Order

Text Size:AAA

Human IL17Rd Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL17RDcDNA Clone Product Information
cDNA Size:2220
cDNA Description:ORF Clone of Homo sapiens interleukin 17 receptor D DNA.
Gene Synonym:SEF, IL-17RD, IL17RLM, FLJ35755, MGC133309, DKFZp434N1928
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

IL-17 Family & Receptor Related Products
Product nameProduct name
Canine IL17 / IL17A ProteinRat IL17RA / IL17R Protein (Fc Tag)Marmoset IL17 / IL17A ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL17 / IL17A ProteinHuman p38 alpha / MAPK14 Protein (Activated in vitro, His Tag)Canine IL-17RD Protein (Fc Tag)Cynomolgus IL17BR / IL17RB / IL-17 Receptor B Protein (ECD, His Tag)Human IL17B / IL-17B Protein (Fc Tag)Rat IL17F / IL-17F Protein (His Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL25 Protein (Fc Tag)Human IL17RD Protein (His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Canine IL17RD Protein (His Tag)Human IL17RA / CD217 Protein (His & Fc Tag)Human IL17RA / CD217 Protein (His Tag)Human IL17 / IL17A Protein (His Tag)Human IL17RC Protein (Fc Tag)Human IL17RC Protein (aa 1-454, His Tag)Mouse IL17F / IL-17F Protein (His Tag)Mouse IL17F / IL-17F ProteinHuman IL-17F / Interleukin-17F Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Human IL17 / IL17A Protein (His Tag)Human IL17 / IL17A ProteinHuman RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Mouse IL17B / IL-17B Protein (Fc Tag)Human IL17RB / IL-17 Receptor B Protein (Flag Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Mouse IL25 Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (Fc Tag)Mouse IL17RA / IL17R / CD217 Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse IL17 / IL17A ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL-17F / IL17F ProteinRat IL17RA / IL17R Protein (His Tag)Rat Interleukin 25 / IL25 / IL17E Protein (Fc Tag)Cynomolgus IL17RA / IL17R Protein (Fc Tag)Mouse IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Human IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)

Interleukin-17 receptor D (IL-17D) also known as Interleukin-17 receptor-like protein, is a member of interleukine-17 recepter family. IL-17RD functions as a feedback inhibitor of fibroblast growth factor mediated Ras-MAPK signaling and ERK activation. It may inhibit FGF-induced FGFR1 tyrosine phosphorylation, regulate the nuclear ERK signaling pathway by spatially blocking nuclear translocation of activated ERK By similarity, and mediate JNK activation and may be involved in apoptosis. IL-17RD is found expressed in the neopallial cortex, rhombic lip and dorsal regions of the myelencephalon and in the frontal nasal process. IL-17RD is also expressed in the commissural plate and septal area of the forebrain and in the hippocampus, lens and optic cup. In the oral region, IL-17RD is expressed in the tongue and in the mesenchyme of the first branchial arch. It is also expressed in the developing inner ear. IL-17RD interacts with both IL-17R-Myc and IL-17RB-Myc. Both the intracellular and extracellular domains of IL-17RD interact with IL-17R. IL-17R forms a heteromeric complex with IL-17RD. Experiment results indicate that IL-17RD is able to affect IL-17R localization, suggesting that these two molecules are colocalized and associate with each other within cells. The fact that IL-17RD Delta ICD is unable to mediate IL-17 signaling but functions as a dominant-negative form indicates that the intracellular domain of IL-17RD is pivotal. In addition, IL-17RD interacts with the IL-17R downstream molecule TRAF6. It has been proposed that the IL-17RD intracellular domain interacts with IL-17R and TRAF6 to deliver the downstream signal.

  • Weaver CT, et al.. (2007) IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol. 25: 821-52.
  • Rong Z, et al.. (2009) IL-17RD (Sef or IL-17RLM) interacts with IL-17 receptor and mediates IL-17 signaling. Cell Res. 19(2): 208-15.
  • Gaffen SL. (2009) Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9(8): 556-67.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items