Quick Order

Human F13B ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human F13B cDNA Clone Product Information
Gene_bank_ref_id:NM_001994.2
RefSeq ORF Size:1986bp
cDNA Description:Full length Clone DNA of Homo sapiens coagulation factor XIII, B polypeptide with C terminal His tag.
Gene Synonym:FXIIIB, F13B
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-F13B-His
Restriction Site:KpnI (two restriction sites) + XbaI (6kb + 1.26kb + 0.78kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human F13B Gene Plasmid Map
Human F13B ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Coagulation factor XIII B chain, also known as Fibrin-stabilizing factor B subunit, Protein-glutamine gamma-glutamyltransferase B chain, Transglutaminase B chain and F13B, is a secreted protein which contains 10 Sushi ( CCP / SCR ) domains. Coagulation factor XIII is the last zymogen to become activated in the blood coagulation cascade. Plasma factor XIII is a heterotetramer composed of 2 A subunits and 2 B subunits. The A subunits have catalytic function, and the B subunits do not have enzymatic activity and may serve as a plasma carrier molecules. Platelet factor XIII is composed of just 2 A subunits, which are identical to those of plasma origin. The B chain of factor XIII is not catalytically active, but is thought to stabilize the A subunits and regulate the rate of transglutaminase formation by thrombin. Factor XIII acts as a transglutaminase to catalyze the formation of gamma-glutamyl-epsilon-lysine crosslinking between fibrin molecules, thus stabilizing the fibrin clot. Factor XIII deficiency is classified into two categories: type I deficiency, characterized by the lack of both the A and B subunits; and type II deficiency, characterized by the lack of the A subunit alone. These defects can result in a lifelong bleeding tendency, defective wound healing, and habitual abortion. Defects in F13B are the cause of factor XIII subunit B deficiency ( FA13BD ) which is an autosomal recessive disorder characterized by a life-long bleeding tendency, impaired wound healing and spontaneous abortion in affected women.

Size / Price
Catalog: HG11510-CH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"