Quick Order

Human F9 / FIX Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
F9cDNA Clone Product Information
cDNA Size:1386
cDNA Description:ORF Clone of Homo sapiens coagulation factor IX DNA.
Gene Synonym:FIX, PTC, HEMB, MGC129641, MGC129642, F9
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Coagulation factor IX, also known as Christmas factor, Plasma thromboplastin component and PTC, is a secreted protein which belongs to the peptidase S1 family. Coagulation factor IX / F9 contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one?peptidase S1 domain. Coagulation factor IX / F9 is a vitamin K-dependent plasma protein that participates in the intrinsic pathway of blood coagulation by converting factor X to its active form in the presence of Ca2+ons, phospholipids, and factor VIIIa. Defects in Coagulation factor IX / F9 are the cause of thrombophilia due to factor IX defect which is a hemostatic disorder characterized by a tendency to thrombosis. Defects in Coagulation factor IX / F9 are also the cause of recessive X-linked hemophilia B ( HEMB ) which also known as Christmas disease.

  • Onay U.V., et al., 2003, Br. J. Haematol. 120:656-659.
  • Vidal F., et al., 2000, Br. J. Haematol. 111:549-551.
  • Simioni P., et al., 2009, N. Engl. J. Med. 361:1671-1675.
  • Espinos C., et al., 2009, Haematologica 88:235-236.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items