After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SUSD4 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SUSD4 cDNA Clone Product Information
Gene_bank_ref_id:BC004888
RefSeq ORF Size:873bp
cDNA Description:Full length Clone DNA of Homo sapiens sushi domain containing 4 with N terminal Myc tag.
Gene Synonym:PRO222, RP11-239E10.4, SUSD4
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SUSD4, also known as sushi domain-containing protein 4, is a hypothetical cell surface protein whose tissue distribution and function are completely unknown. SUSD4 is detectable in murine brains, eyes, spinal cords, and testis but not other tissues. In brains, SUSD4 is highly expressed in the white matter on oligodendrocytes/axons, and in eyes, it is exclusively expressed on the photoreceptor outer segments. In in vitro complement assays, SUSD4 augments the alternative but not the classical pathway of complement activation at the C3 convertase step. SUSD4 deficiency may cause autism or Fryns syndrome, both of which are genetic diseases with severe abnormal neurological development and/or functions.

References
  • Kimura K. et al., 2006, Genome Res. 16 (1): 55-65.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Tu Z. et al., 2010, Am J Pathol. 176 (5): 2378-84.
  • Size / Price
    Catalog: HG13488-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"