Quick Order

Human CUTC Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CUTCcDNA Clone Product Information
Gene_bank_ref_id:NM_015960.2
cDNA Size:822
cDNA Description:ORF Clone of Homo sapiens cutC copper transporter homolog (E. coli) DNA.
Gene Synonym:CGI-32, RP11-483F11.3, CUTC
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CUTC Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name
Background

Copper homeostasis protein cutC homolog, also known as CGI-32 and CUTC, is a cytoplasm and nucleus protein which belongs to the CutC family. CUTC may play a role in copper homeostasis. It can bind one Cu1+ per subunit. Copper is an essential trace element to life and particularly plays a pivotal role in the physiology of aerobic organisms. Copper is a micronutrient that is required for proper metabolic functioning of most prokaryotic and eukaryotic organisms. To sustain an adequate supply of copper, a cell requires molecular mechanisms that control the metal content to avoid copper toxicity. This toxicity comes primarily from the reactivity of copper, which can lead to the generation of free radicals. In bacteria, two independent systems are responsible for maintaining the balance of copper within the cells ( Cop and Cut family proteins ). The Cut protein family is associated with copper homeostasis and involved in uptake, storage, delivery, and efflux of copper. CutC is a member of the Cut family and is suggested to be involved in efflux trafficking of cuprous ion. CutC is able to respond transcriptionally to copper and to participate in the control of copper homeostasis in E. faecalis.

References
  • Lai C.-H., et al., 2000, Genome Res.10:703-713.
  • Li J., et al., 2005, Biochem. Biophys. Res. Commun. 337:179-183.
  • Li,Y. et al., 2010, J Struct Biol. 169 (3):399-405.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Catalog:HG11470-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"