Quick Order

Human NAA10 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NAA10 cDNA Clone Product Information
Gene_bank_ref_id:BC000308
RefSeq ORF Size:708bp
cDNA Description:Full length Clone DNA of Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit with N terminal Flag tag.
Gene Synonym:TE2, ARD1, NATD, ARD1A, DXS707
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

ARD1 is a member of the 20-kDa ARF protein family. It is a multifunctional protein. ARD1 has an 18-kDa ADP-ribosylation factor (ARF) domain at the C-terminus (amino acids 403-574), and a 46-kDa N-terminal domain (amino acids 1-402). The C-terminal region of ARD1 may be involved in the formation of both ARD1-ARD1 and ARD1-NAT1 complexes. ARD1 and NAT1 genes are required for the expression of an N-terminal protein acetyltransferase. This activity is required for full repression of the silent mating type locus HML, for sporulation, and for entry into G0. Recombinant ARD1 (amino acids 1-574) or its RING finger domain (amino acids 1-110) produced polyubiquitylated proteins when incubated in vitro with a mammalian E1, an E2 enzyme, ATP, and ubiquitin.

Size / Price
Catalog: HG14293-NF
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"