Quick Order

Human RYBP ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RYBP cDNA Clone Product Information
Gene_bank_ref_id:BC014959
RefSeq ORF Size:687bp
cDNA Description:Full length Clone DNA of Homo sapiens RING1 and YY1 binding protein with N terminal Flag tag.
Gene Synonym:AAP1, DEDAF, YEAF1, RYBP
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

APAP-1, also known as AAP1 and RYBP, is widely expressed. It is highest expressed in lymphoid tissues and placenta. APAP-1 contains 1 RanBP2-type zinc finger. It may bind to DNA. APAP-1 inhibits ubiquitination and subsequent degradation of TP53, and thereby plays a role in regulating transcription of TP53 target genes. It may be implicated in the regulation of the transcription as a repressor of the transcriptional activity of E4TF1. APAP-1 also promotes apoptosis.

References
  • Li Mao, et al. (2009) RYBP stabilizes p53 by modulating MDM2. EMBO Rep. 10(2):166-72.
  • Schlisio, et al. (2002) Interaction of YY1 with E2Fs, mediated by RYBP, provides a mechanism for specificity of E2F function. EMBO J. 21(21):5775-86.
  • Peter M E, et al. (2001) The death effector domain-associated factor plays distinct regulatory roles in the nucleus and cytoplasm. J Biol Chem. 276(34):31945-52.
  • Size / Price
    Catalog: HG14292-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"