After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ALPL / TNAP ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ALPL cDNA Clone Product Information
Gene_bank_ref_id:NM_000478.4
RefSeq ORF Size:1575bp
cDNA Description:Full length Clone DNA of Homo sapiens alkaline phosphatase, liver/bone/kidney with N terminal His tag.
Gene Synonym:HOPS, TNAP, TNSALP, AP-TNAP, FLJ40094, FLJ93059, MGC161443, MGC167935, ALPL
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Alkaline phosphatase (ALPL) is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules, including nucleotides, proteins, and alkaloids. The process of removing the phosphate group is called dephosphorylation. As the name suggests, alkaline phosphatases are most effective in an alkaline environment. It is sometimes used synonymously as basic phosphatase. Alkaline phosphatases (APs) are ubiquitous in many species, from bacteria to human. Four genes encode AP isoenzymes in humans and rodents. Three AP genes are expressed in a tissue-specific manner (i.e., placental, embryonic, and intestinal AP isoenzymes). Expression of the fourth AP gene is nonspecific to a single tissue and is especially abundant in bone, liver, and kidney. This isoenzyme is also called tissue-nonspecific alkaline phosphatase (TNAP). The enzyme tissue non-specific alkaline phosphatase (TNAP) belongs to the ectophosphatase family. TNAP is present in large amounts in bone in which it plays a role in mineralization.

References
  • Brun-Heath I, et al. (2011) Differential expression of the bone and the liver tissue non-specific alkaline phosphatase isoforms in brain tissues. Cell Tissue Res. 343(3): 521-36.
  • Whyte MP, et al. (1995) Alkaline phosphatase: placental and tissue-non-specific isoenzymes hydrolyze phosphoethanolamine, inorganic pyrophosphate, and pyridoxal 5-phosphate. J Clin Invest. 95: 1440-5.
  • Whyte MP. (1994) Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocrinol Rev. 4: 439-61.
  • Weinreb M, et al. (1990) Different pattern of alkaline phosphatase, osteopontin and osteocalcin expression in developing rat bone visualized by in situ hybridization. J Bone Miner Res. 5: 831-42.
  • Size / Price
    Catalog: HG10440-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"