After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human JTB ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human JTB cDNA Clone Product Information
NCBI RefSeq:BC000499
RefSeq ORF Size:441bp
cDNA Description:Full length Clone DNA of Homo sapiens jumping translocation breakpoint with N terminal Myc tag.
Gene Synonym:PAR, hJT, HJTB, HSPC222, JTB
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Jumping translocation breakpoint, also known as JTB, is a member of the JTB family. Jumping translocation (JT) is an unbalanced translocation that comprises amplified chromosomalsegments jumping to various telomeres. JTB is expressed in all normal human tissues studied but overexpressed or underexpressed in many of their malignant counterparts. It is required for normal cytokinesis during mitosis. JTB plays a role in the regulation of cell proliferation. It may be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly.

References
  • Hatakeyama S. et al., 1999, Oncogene. 18 (12): 2085-90.
  • Platica O. et al., 2000, Int J Oncol. 16 (5): 1055-61.
  • Erhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catalog: HG13447-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"