After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SCG2 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human SCG2 cDNA Clone Product Information
NCBI RefSeq:BC022509
RefSeq ORF Size:1854bp
cDNA Description:Full length Clone DNA of Homo sapiens secretogranin II (chromogranin C) with N terminal Myc tag.
Gene Synonym:SN, CHGC, SgII, SCG2
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Kit ligand, also known as Hematopoietic growth factor KL, Mast cell growth factor, Steel factor, Stem cell factor, c-Kit ligand, Kitlg and KITL, is a single-pass type I membrane protein which belongs to the SCF family. KITL / kit ligand also belongs to the family of dimeric transmembrane growth factors. The soluble form of KIT ligand is a secreted protein. Mast cells are thought to participate in a variety of immune responses, such as parasite resistance and the allergic reaction. Mast cell development depends on stem cell factor (Kit ligand) and its receptor, c-Kit. KITL / kit ligand stimulates the proliferation of mast cells. KITL / kit ligand is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. Efficient cell surface presentation of KITL / kit ligand is essential for the migration, proliferation, and survival of melanocytes, germ cells, hemopoietic stem cells, and mastocytes. KITL / kit ligand acts synergistically with other cytokines, probably interleukins. KITL / kit ligand plays a crucial role in the development and maintenance of the melanocyte lineage in adult skin. It exerts permanent survival, proliferation and migration functions in Kit receptor-expressing melanocytes. KITL / kit ligand misexpression in some hyperpigmented lesions may open the avenue for Kitl-dependent treatment of pathological skin conditions.

References
  • Nishida,K.et al., 2002, Blood. 99 (5):1866-9.
  • Paulhe,F. et al., 2004,J Biol Chem. 279 (53):55545-55.
  • Fernandez,S.M. et al., 2008,Biol Reprod. 79 (2):318-27.
  • Wehrle-Haller,B. et al., 2003,Pigment Cell Res.16 (3):287-96.
  • Size / Price
    Catalog: HG13441-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"