Quick Order

Human SR-A / MSR1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MSR1 cDNA Clone Product Information
Gene_bank_ref_id:NM_138715.2
RefSeq ORF Size:1356bp
cDNA Description:Full length Clone DNA of Homo sapiens macrophage scavenger receptor 1 with N terminal His tag.
Gene Synonym:SR-A, CD204, phSR1, phSR2, SCARA1, MSR1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Macrophage scavenger receptor types I and II, also known as Macrophage acetylated LDL receptor I and II, Scavenger receptor class A member 1, CD204, MSR1 and SCARA1, is a single-pass type I I membrane protein which contains one collagen-like domain and one SRCR domain. Macrophages are distributed in all peripheral tissues and play a critical role in the first line of the innate immune defenses against bacterial infection by phagocytosis of bacterial pathogens through the macrophage scavenger receptor 1 (MSR1). MSR1 / SCARA1 is one of the membrane glycoproteins implicated in the pathologic deposition of cholesterol in arterial walls during atherogenesis. Two types of receptor subunits exist. These receptors mediate the endocytosis of a diverse group of macromolecules, including modified low density lipoproteins (LDL). MSR1 / SCARA1 is also involved in chronic inflammation which is a risk factor for prostate cancer. MSR1 1 gene was identified as a candidate susceptibility gene for hereditary prostate cancer and as a risk factor for sporadic prostate cancer.

References
  • Wang L. et al., 2003, Nat Genet. 35 (2): 128-9.
  • Chen Y.C. et al., 2008, Cancer Epidemiol Biomarkers Prev. 17 (4): 1001-3.
  • Shirato K. et al., 2009, Pflugers Arch. 459 (1): 93-103.
  • Sun J. et al., 2006, Prostate. 66 (7): 728-37.
  • Size / Price
    Catalog: HG10427-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"