Quick Order

Text Size:AAA

Human ADAMTS5 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ADAMTS5 cDNA Clone Product Information
Gene_bank_ref_id:NM_007038.3
RefSeq ORF Size:2793bp
cDNA Description:Full length Clone DNA of Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 5 (ADAMTS5) with N terminal His tag.
Gene Synonym:ADMP-2, ADAMTS11, FLJ36738, ADAMTS5
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-ADAMTS5
Restriction Site:KpnI + XbaI (6kb + 2.84kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 333G/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG10423-NH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"