After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MAP2K6 / MKK6 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAP2K6 cDNA Clone Product Information
NCBI RefSeq:NM_002758.3
RefSeq ORF Size:1005bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase 6 (MAP2K6) with N terminal His tag.
Gene Synonym:MEK6, MKK6, MAPKK6, PRKMK6, SAPKK3, MAP2K6
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Dual specificity mitogen-activated protein kinase kinase 6, also known as MAP kinase kinase 6, MAPKK 6, MAPK / ERK kinase 6, SAPKK3, MAP2K6 and MKK6, is a protein which belongs to the?protein kinase superfamily, STE Ser / Thr protein kinase family and MAP kinase kinase subfamily. MAP2K6 / MKK6 contains one?protein kinase domain. Mitogen-activated protein kinases are members of a conserved cascade of kinases involved in many signal transduction pathways. They stimulate phosphorylation of transcription factors in response to extracellular signals such as growth factors, cytokines, ultraviolet light, and stress-inducing agents. MAP2K6 / MKK6 exists in a variety of alternatively spliced isoforms with distinct patterns of tissue expression. Isoform 2 of MAP2K6 / MKK6 is only expressed in skeletal muscle. Isoform 1 of MAP2K6 / MKK6 is expressed in skeletal muscle, heart, and in lesser extent in liver or pancreas.

Size / Price
Catalog: HG10422-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"