After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human B3GNT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
B3GNT2cDNA Clone Product Information
Gene_bank_ref_id:NM_006577.5
cDNA Size:1194
cDNA Description:ORF Clone of Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 DNA.
Gene Synonym:B3GN-T2, B3GNT, B3GNT-2, B3GNT1, BETA3GNT, BGNT2, BGnT-2
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

B3GNT2 belongs to the beta-1,3-N-acetylglucosaminyltransferase family. It is a type II transmembrane protein which prefers the substrate of lacto-N-neotetraose. Alternative splicing produced 2 isoforms of the human protein. B3GNT2 catalyzes the initiation and elongation of poly-N- acetyllactosamine chains. Enzymatic activities of some glycosyltransferases are markedly increased via complex formation with other transferases or cofactor proteins. B3GNT2 and beta3Gn-T8 can form a heterodimer in vitro and that the complex exhibits much higher enzymatic activity than either enzyme alone. It is found that up-regulation of beta3Gn-T8 in differentiated HL-60 cells may increases poly-N-acetyllactosamine chains by activating intrinsic B3GNT2.

References
  • Australo-An, et al. (2010) Genome-wide association study of ankylosing spondylitis identifies non-MHC susceptibility loci. Nat Genet. 42(2):123-7.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Seko A, et al. (2008) Activation of beta1,3-N-acetylglucosaminyltransferase-2 (beta3Gn-T2) by beta3Gn-T8. Possible involvement of beta3Gn-T8 in increasing poly-N-acetyllactosamine chains in differentiated HL-60 cells. J Biol Chem. 283(48):33094-100.
  • Size / Price
    Catalog:HG11416-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"