Quick Order

Human CHK2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CHEK2 cDNA Clone Product Information
Gene_bank_ref_id:NM_007194.3
RefSeq ORF Size:1632bp
cDNA Description:Full length Clone DNA of Homo sapiens CHK2 checkpoint homolog (S. pombe) with C terminal His tag.
Gene Synonym:CDS1, CHK2, LFS2, RAD53, HuCds1, PP1425, CHEK2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Bogdanova N, et al. (2005) Association of two mutations in the CHEK2 gene with breast cancer. Cancer Genetics. 116(2) : 263-6.
  • Dong XY, et al. (2003) Mutations in CHEK2 associated with prostate cancer risk. The American journal of human genetics. 72(2) 270-80.
  • Size / Price
    Catalog: HG11414-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"