After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MBL Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MBL2cDNA Clone Product Information
Gene_bank_ref_id:NM_000242.2
cDNA Size:747
cDNA Description:ORF Clone of Homo sapiens mannose-binding lectin (protein C) 2, soluble (opsonic defect) DNA.
Gene Synonym:MBL, MBP, MBP1, COLEC1, HSMBPC, MGC116832, MGC116833, MBL2
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

MBL (mannose-binding lectin) is primarily a liver-derived collagen-like serum protein, which binds sugar structures on micro-organisms and on dying host cells and is one of the four known mediators that initiate activation of the complement system via the lectin pathway. MBL and the ficolins (Ficolin-1, Ficolin-2 and Ficolin-3) are soluble collagen-like proteins that are involved in innate immune defence. They bind sugar structures or acetylated compounds present on microorganisms and on dying host cells and they initiate activation of the lectin complement pathway in varying degrees. MBL2 encodes the mannose-binding lectin, which is a key player in the innate immune system and has recently been found to play a role in development of type 1 diabetes and gestational diabetes mellitus. Common variant alleles situated both in promoter and structural regions of the MBL2 gene influence the stability and the serum concentration of the protein. Several polymorphisms in the promoter and structural regions of MBL2 adversely affect the plasma concentration and oligomeric state of MBL. The possession of mutant alleles has been linked to disease outcome for a variety of bacterial and viral infections. Mutant MBL2 haplotypes have been linked to disease progression and response to therapy in HCV infection.

References
  • Garred P, et al. (2006) Mannose-binding lectin and its genetic variants. Genes Immun. 7(2): 85-94.
  • Brown KS, et al. (2007) Mannan binding lectin and viral hepatitis. Immunol Lett. 108(1): 34-44.
  • Garred P. (2008) Mannose-binding lectin genetics: from A to Z. Biochem Soc Trans. 36(Pt 6): 1461-6.
  • Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.
  • Muller YL, et al. (2010) Functional Variants in MBL2 Are Associated With Type 2 Diabetes and Pre-Diabetes Traits in Pima Indians and the Old Order Amish. Diabetes. 59(8): 2080-5.
  • Size / Price
    Catalog:HG10405-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"