Quick Order

Text Size:AAA

Human SULT2B1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SULT2B1cDNA Clone Product Information
Gene_bank_ref_id:NM_177973.1
cDNA Size:1098
cDNA Description:ORF Clone of Homo sapiens sulfotransferase family, cytosolic, 2B, member 1 DNA.
Gene Synonym:HSST2, SULT2B1
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human SULT2B1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name
Background

Sulfotransferase family cytosolic 2B member 1, also known as Sulfotransferase 2B1, ST2B1, Alcohol sulfotransferase, Hydroxysteroid sulfotransferase 2, SULT2B1 and HSST2, is a cytoplasm protein which belongs to the sulfotransferase 1 family. The human hydroxysteroid sulfotransferase (SULT) family is comprised of two subfamilies, SULT2A1 and SULT2B1. SULT2B1 is expressed highly in placenta, prostate and trachea. A lesser expression of SULT1B1 was observed in the small intestine and lung. SULT2B1 catalyzes the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. SULT2B1 sulfates hydroxysteroids like DHEA. Isoform 1 preferentially sulfonates cholesterol. The two SULT2B1 isoforms, SULT2B1a and SULT2B1b, are encoded by a single gene as a result of alternative transcription initiation and alternative splicing. SULT2B1b catalyzes the sulfonation of 3beta-hydroxysteroid hormones and cholesterol, whereas SULT2B1a preferentially catalyzes pregnenolone sulfonation.

References
  • Fujita K. et al., 1997, J. Biochem. 122:1052-61.
  • Geese,WJ. et al., 2001,Biochem Biophys Res Commun.288 (1): 280-9.
  • Shimizu,C. et al., 2003, Endocrinology. 144 (4):1186-93.
  • Ji,Y. et al., 2007, J Pharmacol Exp Ther. 322 (2): 529-40.
  • Size / Price
    Catalog:HG11410-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"