Quick Order

Cynomolgus monkey OPALIN ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus OPALIN cDNA Clone Product Information
Gene_bank_ref_id:XM_005566083.1
RefSeq ORF Size:426bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) oligodendrocytic myelin paranodal and inner loop protein with C terminal HA tag.
Gene Synonym:OPALIN
Species:Cynomolgus
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Opalin, or oligodendrocytic myelin paranodal and inner loop protein, is a transmembrane protein detected specifically in mammalian oligodendrocytes, and may play significant role in oligodendrocyte differentiation and myelination.Opalin has binding sites for Myt1 and cAMP-response element binding protein (CREB). Over-expression of Myt1, treatment of the cell with leukemia inhibitory factor (LIF), and cAMP analog (CREB activator) enhanced the expression of endogenous Opalin in Oli-neu cells and activated the oligodendrocyte enhancer. Thus LIF, cAMP signaling cascades and Myt1 may play significant roles in the differentiation of oligodendrocytes through their action on the Opalin oligodendrocyte enhancer. Enzymatic deglycosylation showed that myelin Opalin contained N- and O-glycans, and that the O-glycans, at least, had negatively charged sialic acids. Site-directed mutations at the glycan sites impaired the cell surface localization of Opalin. In addition to the somata and processes of oligodendrocytes, Opalin immunoreactivity was observed in myelinated axons in a spiral fashion, and was concentrated in the paranodal loop region. Immunogold electron microscopy demonstrated that Opalin was localized at particular sites in the paranodal loop membrane. These results suggest a role for highly sialylglycosylated Opalin in an intermembranous function of the myelin paranodal loops in the central nervous system.

References
  • Aruga J, et al. (2007) An oligodendrocyte enhancer in a phylogenetically conserved intron region of the mammalian myelin gene Opalin. J Neurochem. 102(5):1533-47.
  • Kippert A, et al. (2008) Identification of Tmem10/Opalin as a novel marker for oligodendrocytes using gene expression profiling. BMC Neurosci. 9:40.
  • Yoshikawa F, et al. (2008) Opalin, a transmembrane sialylglycoprotein located in the central nervous system myelin paranodal loop membrane. J Biol Chem. 83(30):20830-40.
  • Golan N, et al. (2008) Identification of Tmem10/Opalin as an oligodendrocyte enriched gene using expression profiling combined with genetic cell ablation. Glia. 56(11):1176-86.
  • Size / Price
    Catalog: CG90667-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"