Quick Order

Human IL20Ra Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL20RAcDNA Clone Product Information
cDNA Size:1662
cDNA Description:ORF Clone of Homo sapiens interleukin 20 receptor, alpha (IL20RA) DNA.
Gene Synonym:IL-20R1, ZCYTOR7, FLJ40993, IL20RA
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

IL-10 Family & Receptor Related Products

Interleukin 20 receptor, alpha subunit (IL20RA/IL-20RA) also known as IL-20 receptor subunit alpha, Cytokine receptor class-II member 8, interleukin-20 receptor I, and interleukin-20 receptor subunit alpha, is a subunit for the interleukin-20 receptor. IL20RA/IL-20RA belongs to the type II cytokine receptor family. This cytokine is a receptor for interleukin 20 (IL20), a cytokine that may be involved in epidermal function. The receptor of IL20 is a heterodimeric receptor complex consisting of this protein and interleukin 20 receptor beta (IL20B). IL20RA forms heterodimer with IL20RB, and the complex serves as a receptor for IL19, IL20 and IL24. All three are capable of signaling through IL-20RA/IL-20RB complex. The ligand binding to receptor B creating a high-affinity binding site for the receptor A which is recruited to complete the complex. In addition, IL20RA also forms a heterodimer with the unique and specific receptor IL10RB and functions as the receptor for IL26. IL20RA is widely expressed with highest levels in skin, testis and brain. The expression of both IL20RA and IL20RB is found to be upregulated in psoriatic skin lesions on keratinocytes.

  • Parrish-Novak J, et al. (2002) Interleukins 19, 20, and 24 signal through two distinct receptor complexes. Differences in receptor-ligand interactions mediate unique biological functions. J Biol Chem. 277(49): 47517-23.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5): 445-51.
  • Blumberg H, et al. (2001) Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell. 104(1): 9-19.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items