After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CES2cDNA Clone Product Information
cDNA Size:1872
cDNA Description:ORF Clone of Homo sapiens carboxylesterase 2 (intestine, liver) DNA.
Gene Synonym:iCE, CE-2, PCE-2, CES2A1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10380-ACG$345
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10380-ACR$345
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10380-ANG$345
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10380-ANR$345
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10380-CF$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10380-CH$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10380-CM$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10380-CY$315
Human CES2 Gene cDNA Clone (full-length ORF Clone)HG10380-M$195
Human CES2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10380-M-F$395
Human CES2 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10380-M-N$395
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10380-NF$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10380-NH$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10380-NM$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10380-NY$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10380-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Carboxylesterase 2 (CES2) is a member of the carboxylesterase family and belongs to the multigene family. Carboxylesterase 2 is responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and beroin. It also serves to hydrolyze long-chain fatty acid esters and thioesters. It is speculated that carboxylesterases may play a role in lipid metabolism and the blood-brain barrier system and together with isform 1, are a serine esterase involved in both drug metabolism and activation. Human carboxylesterase 2 is commonly expressed in tumor tissues and irinotecan, a topoisomerase I inhibitor commonly used in the treatment of many solid tumors.

  • Imai T. et al. (2006) Human carboxylesterase isozymes: catalytic properties and rational drug design. Drug metab pharmacokinet. 21 (3): 173-85.
  • Guang Xu, et al. (2002) Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan. Clin Cancer Res. 8: 2605.
  • Zhang, et al. (2002) Comprehensive Evaluation of Carboxylesterase-2 Expression in Normal Human Tissues Using Tissue Array Analysis. Applied Immunohistochemistry & Molecular Morphology. 10 (4): 374-80.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items