After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ITGA5cDNA Clone Product Information
cDNA Size:3150
cDNA Description:ORF Clone of Homo sapiens integrin, alpha 5 (fibronectin receptor, alpha polypeptide) DNA.
Gene Synonym:FNRA, CD49e, VLA5A
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10366-ACG$425
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10366-ACR$425
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10366-CF$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10366-CH$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10366-CM$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10366-CY$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone)HG10366-M$145
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10366-M-F$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-taggedHG10366-M-M$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10366-M-N$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10366-NF$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10366-NH$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10366-NM$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10366-NY$395
Human Integrin alpha5 / CD49e Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10366-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $395.00  (Save $0.00)
Price:$395.00      [How to order]
Availability2-3 weeks