Quick Order

Human GADD45G Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GADD45GcDNA Clone Product Information
cDNA Size:480
cDNA Description:ORF Clone of Homo sapiens growth arrest and DNA-damage-inducible, gamma DNA.
Gene Synonym:RP11-260L6.1, CR6, DDIT2, GADD45gamma, GRP17, GADD45G
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human GADD45G Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name

GADD45G, also known as CR6, is part of the nuclear proteins to interact with various proteins whose transcript levels are raised after stressful growth arrest conditions and treatment with DNA-damaging agents. GADD45G reacts to environmental stresses by mediating activation of the p38/JNK pathway which is mediated through their protein binding and activating MTK1/MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. GADD45G acts as a new-age tumor suppressor however is being frequently inactivated epigenetically in multiple tumors. GADD45G mRNA expression is down-regulated in hepatocellular carcinoma. GADD45G causes cell cycle arrest at G2/M transition when transfected into Hep-G2 cells. GADD45G induction by androgens involves new protein synthesis. Overexpression of GADD45G inhibits cell growth and causes morphological modifications in prostate cell lines thus GADD45G takes part in differentiation induction by androgens.

  • Takekawa M. et al., 1998, Cell. 95 (4): 521-30.
  • Suzuki M. et al., 1999, J Hum Genet. 44 (5): 300-3.
  • Azam N. et al., 2001, J Biol Chem. 276 (4): 2766-74.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items