Quick Order

Text Size:AAA

Cynomolgus monkey CIRBP ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus CIRBP cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:519bp
cDNA Description:Full length Clone DNA of Macaca mulatta cold inducible RNA binding protein with C terminal HA tag.
Gene Synonym:CIRBP
Species:Cynomolgus
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CIRBP, also known as cold-inducible RNA-binding protein, plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. CIRBP responds to a wide array of cellular stresses, including short wavelength ultraviolet light (UVC), at the transcriptional and post-translational level. It acts as a translational activator.CIRBP can bind the 3 translated region of specific transcripts to stabilize them and facilitate their transport to ribosomes for translation. CIRBP affects NF-κB signaling as opposed to IL1B mRNA stability directly.

References
  • Artero-Castro A. et al., 2009, Mol Cell Biol. 29 (7): 1855-68.
  • Zeng Y. et al., 2009, J Cell Biochem. 107 (1): 179-88.
  • Brochu C. et al., 2013, PLoS One. 8 (2): e57426.
  • Size / Price
    Catalog: CG90629-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"