Quick Order

Human ANTXR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
ANTXR1cDNA Clone Product Information
Gene Bank Ref.ID:BC012074
cDNA Size:1002
cDNA Description:ORF Clone of Homo sapiens anthrax toxin receptor 1 DNA.
Gene Synonym:ATR, TEM8, ANTXR1
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

ANTXR1 contains 1 VWFA domain and belongs to the ATR family. ATR (Ataxia telangiectasia and Rad3 related) and ATM (Ataxia telangiectasia mutated) are closely related kinases that are activated by DNA damage. They are serine-threonine protein kinases and belongs to the phosphatidylinositol 3' kinase-like kinase (PIKK) family. Upon recruitment by the DNA damage binding proteins/complexes (ATRIP for ATR; MRN for ATM), ATM/ATR initiate the DNA damage checkpoint by phosphorylating a number of key proteins. ANTXR1 interacts with extracellular matrix proteins and with the actin cytoskeleton. It functions in cell attachment and migration. ANTXR1 also mediates adhesion of cells to type 1 collagen and gelatin, reorganization of the actin cytoskeleton and promotes cell spreading. It plays a role in the angiogenic response of cultured umbilical vein endothelial cells.

Reference
  • Chaudhary A, et al. (2012) TEM8/ANTXR1 blockade inhibits pathological angiogenesis and potentiates tumoricidal responses against multiple cancer types. Cancer Cell. 21 (2): 212-26.
  • Garlick KM, et al. (2012) Binding of filamentous actin to anthrax toxin receptor 1 decreases its association with protective antigen. Biochemistry. 51 (6): 1249-56.
  • St Croix B, et al. (2000) Genes expressed in human tumor endothelium. Science. 289 (5482): 1197-202.
  • Size / Price
    Catalog:HG13367-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks
    Images
      Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"