Quick Order

Text Size:AAA

Human IVD Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IVDcDNA Clone Product Information
Gene_bank_ref_id:BC017202
cDNA Size:1272
cDNA Description:ORF Clone of Homo sapiens isovaleryl-CoA dehydrogenase DNA.
Gene Synonym:ACAD2, FLJ12715, FLJ34849, IVD
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Isovaleryl-CoA dehydrogenase, also known as IVD, plays an essential role in processing proteins obtained from the diet. The body breaks down proteins from food into smaller parts called amino acids. Amino acids can be further processed to provide energy for growth and development. Isovaleryl-CoA dehydrogenase helps process a particular amino acid called leucine. Specifically, isovaleryl-CoA dehydrogenase is responsible for the third step in the breakdown of leucine. This step is a chemical reaction that converts a molecule called isovaleryl-CoA to another molecule, 3-methylcrotonyl-CoA. Additional chemical reactions convert 3-methylcrotonyl-CoA into molecules that are used for energy.

References
  • BACHHAWAT BK, et al. (1956) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • Ikeda Y, et al. (1983) Purification and characterization of isovaleryl coenzyme A dehydrogenase from rat liver mitochondria. J Biol Chem. 258(2):1077-85.
  • Tanaka K, et al. (1966) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"