After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human IFNW1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IFNW1 cDNA Clone Product Information
Gene_bank_ref_id:NM_002177.1
RefSeq ORF Size:588bp
cDNA Description:Full length Clone DNA of Homo sapiens interferon, omega 1 with N terminal His tag.
Gene Synonym:IFNW1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

IFNs are a large family of proteins having antiviral, antiproliferative, and immunomodulatory effects, and are divided into two major classes, type I  and type I I, on the basis of differences in receptor binding and nucleotide sequence. Type I IFNs consist of IFN α, β, τ, and ω and bind to the type I  IFN receptor, whereas IFN-γ is the only type I I IFN and is specific for the type I I IFN receptor. Human IFN-ω, was identified by three independent groups in 1985 and is structurally related to IFN-α and -β. Both human IFN-ω and IFN-α are produced by virally induced leukocytes and have similar antiviral activities on human cell lines, and a sizeable proportion (at least 10%) of the total antiviral activity of leukocyte IFN is contributed by IFN-ωl. In addition, it was reported that IFN-ω could inhibit the growth of human tumors in vivo.

Size / Price
Catalog: HG10353-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"