Quick Order

Text Size:AAA

Human CYGB Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CYGBcDNA Clone Product Information
Gene_bank_ref_id:BC029798
cDNA Size:573
cDNA Description:ORF Clone of Homo sapiens cytoglobin DNA.
Gene Synonym:HGB, STAP, CYGB
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Cytoglobin, also known as CYGB, is a globin molecule ubiquitously expressed in all tissues and most notably utilized in marine mammals. Its avtual function is still unknown. It is thought to be a method of protection under conditions of hypoxia. The predicted function of cytoglobin is the transfer of oxygen from arterial blood to the brain. Cytoglobin is also present in chondroblasts and osteoblasts and shows a decreased level of expression upon differentiation to chondrocytes and osteocytes. Cytoglobin may facilitate diffusion of oxygen through tissues, scavenge nitric oxide or reactive oxygen species, or serve a protective function during oxidative stress.

References
  • Burmester T. et al., 2002, Mol Biol Evol. 19 (4): 416-21.
  • Trent JT. et al., 2002, J Biol Chem. 277 (22): 19538-45.
  • Kawada N. et al., 2001, J Biol Chem. 276 (27): 25318-23.
  • Schmidt M. et al., 2004, J Biol Chem. 279 (9): 8063-9.
  • Size / Price
    Catalog:HG14367-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"