Quick Order

Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GGCTcDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:567
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) gamma-glutamylcyclotransferase DNA.
Gene Synonym:GGCT
Species:Cynomolgus
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90618-ACG$325
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90618-ACR$325
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90618-ANG$325
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90618-ANR$325
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90618-CF$295
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90618-CH$295
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90618-CM$295
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90618-CY$295
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone)CG90618-G$95
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90618-NF$295
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90618-NH$295
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90618-NM$295
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90618-NY$295
Cynomolgus monkey GGCT Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90618-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

GGCT belongs to the gamma-glutamylcyclotransferase family. It catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism. GGCT may play a significant role in glutathione homeostasis. GGCT also induces release of cytochrome c from mitochondria with resultant induction of apoptosis. Pseudogenes of GGCT gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

References
  • Wagner SA. et al., 2011, Mol Cell Proteomics. 10 (10): M111.013284.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Amano T. et al., 2012, J Histochem Cytochem. 60 (1): 76-86.
  • Size / Price
    Catalog:CG90618-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"