Quick Order

Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DICER1cDNA Clone Product Information
Gene_bank_ref_id:NM_030621.3
cDNA Size:5769
cDNA Description:ORF Clone of Homo sapiens dicer 1, ribonuclease type I II DNA.
Gene Synonym:DCR1, Dicer, HERNA, KIAA0928, DICER1
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11350-ACG$645
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11350-ACR$645
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11350-ANG$645
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11350-ANR$645
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11350-CF$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11350-CH$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11350-CM$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11350-CY$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone)HG11350-M$495
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11350-M-F$745
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11350-M-N$745
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11350-NF$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11350-NH$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11350-NM$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11350-NY$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11350-UT$615
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:HG11350-CH
List Price: $615.00  (Save $0.00)
Price:$615.00      [How to order]
Availability2-3 weeks
Images
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"