Quick Order

Human MYC ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MYC cDNA Clone Product Information
NCBI RefSeq:NM_002467.3
RefSeq ORF Size:1365bp
cDNA Description:Full length Clone DNA of Homo sapiens v-myc myelocytomatosis viral oncogene homolog (avian) with C terminal His tag.
Gene Synonym:c-Myc, bHLHe39, MYC
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-MYC-His
Restriction Site:KpnI + XbaI (6kb + 1.42kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MYC Gene Plasmid Map
Human MYC Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein. It can help to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. Myc Tag also can be used to isolate protein complexes with multiple subunits. The Myc Tag Antibody is produced by the conjugation of a synthetic Myc tag peptide to KLH. Myc Tag Antibody can be used in various immunoassays, such as ELISA, Western blotting, immunoprecipitation, immunofluorescence, and more.

References
  • Ding X, et al., 2009, PLoS One. 4(6): e5949.
  • Ratsima H, et al., 2011, Proc Natl Acad Sci. 108(43): E914-23.
  • Chiang YJ, et al., 2013, PLoS One. 8(4): e61761.
  • Size / Price
    Catalog: HG11346-CH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"