After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTGDS Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTGDScDNA Clone Product Information
Gene_bank_ref_id:BC005939
cDNA Size:573
cDNA Description:ORF Clone of Homo sapiens prostaglandin D2 synthase 21kDa (brain) DNA.
Gene Synonym:PDS, PGD2, PGDS, LPGDS, PGDS2, L-PGDS, PTGDS
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

PTGDS, also known as L-PGDS, belongs to the calycin superfamily,lipocalin family. Lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. PTGDS is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of PGH2 to PGD2. It is involved in smooth muscle contraction/relaxation and a variety of central nervous system functions. PTGDS may have an anti-apoptotic role in oligodendrocytes. It binds small non-substrate lipophilic molecules, including biliverdin, bilirubin, retinal, retinoic acid and thyroid hormone, and may act as a scavenger for harmful hydrophopic molecules and as a secretory retinoid and thyroid hormone transporter. It is likely to play important roles in both maturation and maintenance of the central nervous system and male reproductive system.

References
  • Aebersold R, et al. (1993) Identification of a brain-specific human cerebrospinal fluid glycoprotein, beta-trace protein. Theor Electrophor. 3:229-234.
  • Oliver K, et al. (2004) DNA sequence and analysis of human chromosome 9. Nature. 429:369-374.
  • Bonaldo MF, et al. (1997) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 6(9):791-806.
  • Size / Price
    Catalog:HG13346-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"