Quick Order

Human HAPLN1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAPLN1cDNA Clone Product Information
cDNA Size:1065
cDNA Description:ORF Clone of Homo sapiens hyaluronan and proteoglycan link protein 1 DNA.
Gene Synonym:CRTL1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Hyaluronan (HA) is a high MW glycosaminoglycan significantly involved in the formation and stability of extracellular matrix via its association with specific HA-binding proteins. HAPLN1, also known as CRTL1 (Cartilage Link Protein 1, cLP ) and link protein, is a member of HA-binding protein (hyaladherins) family, and contains a common structural domain of about 100 amino acids that is termed a Link module with two α-helices and two antiparallel β-sheets. HAPLN1/CRTL1 stabilizes the interaction between hyaluronan (HA) and versican, two extracellular matrix components essential for cardiac development. Link module superfamily can be divided into three subgroups, and the HAPLN family are C domain-type proteins that have an extended structure with one N-terminal V-type Ig-like domain followed by two link modules. In cartilage, aggrecan forms - cLP stabilized aggregates with HA that provides the tissue with its load bearing properties. HAPLN1 is a component of follicular matrix, was shown to enhance cumulus-oocyte complex (COC) expansion in vitro. HAPLN1 may promote periovulatory granulosa cell survival, which would facilitate their differentiation into luteal cells.

  • Sun GW, et al. (2003) Follicle-stimulating hormone and insulin-like growth factor I synergistically induce up-regulation of cartilage link protein (Crtl1) via activation of phosphatidylinositol-dependent kinase/Akt in rat granulosa cells. Endocrinology. 144(3): 793-801.
  • Wirrig EE, et al. (2007) Cartilage link protein 1 (Crtl1), an extracellular matrix component playing an important role in heart development. Dev Biol. 310(2): 291-303.
  • Liu J, et al. (2010) Periovulatory expression of hyaluronan and proteoglycan link protein 1 (Hapln1) in the rat ovary: hormonal regulation and potential function. Mol Endocrinol. 24(6): 1203-17.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks