Quick Order

Human FUT10 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FUT10 cDNA Clone Product Information
Gene_bank_ref_id:NM_032664.3
RefSeq ORF Size:1440bp
cDNA Description:Full length Clone DNA of Homo sapiens fucosyltransferase 10 (alpha (1,3) fucosyltransferase) with C terminal His tag.
Gene Synonym:MGC11141, FUT10
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Breton, C. et al., 1998, Glycobiology. 8 (1): 87-94.
  • Oriol, R. et al., 1999, Glycobiology. 9 (4): 323-34.
  • de Vries, T. et al., 2001, Glycobiology. 11 (10): 119R-128R.
  • Baboval, T. et al., 2002, Mamm. Genome. 13: 538-541.
  • Size / Price
    Catalog: HG11327-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"