After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FUT8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FUT8cDNA Clone Product Information
Gene_bank_ref_id:NM_178154.1
cDNA Size:1728
cDNA Description:ORF Clone of Homo sapiens fucosyltransferase 8 (alpha (1,6) fucosyltransferase) DNA.
Gene Synonym:MGC26465, FUT8
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Human alpha (1,6) fucosyltransferase 8, also known as FUT8, is a member of the glycosyltransferase family. Fucosyltransferases are the enzymes transferring fucose from GDP-Fuc to Gal in an alpha1,2-linkage and to GlcNAc in alpha1,3-linkage, alpha1,4-linkage, or alpha1,6-linkage. All fucosyltransferases utilize the same nucleotide sugar, their specificity reside in the recognition of the acceptor and in the type of linkage formed. Fucosyltransferases share some common structural and catalytic features. On the basis of protein sequence similarities, these enzymes can be classified into four distinct families: (1) the alpha-2-fucosyltransferases, (2) the alpha-3-fucosyltransferases, (3) the mammalian alpha-6-fucosyltransferases, and (4) the bacterial alpha-6-fucosyltransferases. The alpha-3-fucosyltransferases constitute a distinct family as they lack the consensus peptide, but some regions display similarities with the alpha-2 and alpha-6-fucosyltranferases.

References
  • Breton C, et al. (1998) Conserved structural features in eukaryotic and prokaryotic fucosyltransferases. Glycobiology. 8(1): 87-94.
  • Oriol R, et al. (1999) Divergent evolution of fucosyltransferase genes from vertebrates, invertebrates, and bacteria. Glycobiology. 9(4): 323-34.
  • de Vries T, et al. (2001) Fucosyltransferases: structure / function studies. Glycobiology. 11(10): 119-128.
  • Baboval T, et al. (2002) Comparison of human and mouse Fuc-TX and Fuc-TXI genes, and expression studies in the mouse. Mamm Genome. 13(9): 538-41.
  • Size / Price
    Catalog:HG11326-CH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"