After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CXCR4 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CXCR4 cDNA Clone Product Information
Gene_bank_ref_id:NM_001008540.1
RefSeq ORF Size:1071bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) receptor 4 with C terminal His tag.
Gene Synonym:FB22, HM89, LAP3, LCR1, NPYR, WHIM, CD184, LESTR, NPY3R, NPYRL, HSY3RR, NPYY3R, D2S201E, CXCR4
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-CXCR4-His
Restriction Site:KpnI + XbaI (6kb + 1.12kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CXCR4 Gene Plasmid Map
Human CXCR4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Size / Price
Catalog: HG11325-CH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"