Quick Order

Text Size:AAA

Human ROBO2 transcript variant 2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ROBO2 cDNA Clone Product Information
Gene_bank_ref_id:NM_002942.4
RefSeq ORF Size:4137bp
cDNA Description:Full length Clone DNA of Homo sapiens roundabout, axon guidance receptor, homolog 2 (Drosophila), transcript variant 2 with N terminal His tag.
Gene Synonym:SAX3, KIAA1568
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ROBO2 belongs to the ROBO family. Members of the ROBO family are a group of highly conserved transmembrane glycoproteins that make up a small subgroup of the immunoglobulin (Ig) superfamily. They are best known for their roles as receptors for the Slit family of repellent axon guidance cues. In structure, ROBOs are characterized by five C2-type Ig-like repeats, three fibronectin type III domains, a transmembrane region, and an intracellular domain with three (ROBO3) or four (ROBO1, 2) CC (conserved cytoplasmic) motifs. ROBO2 is a receptor for SLIT2, and probably SLIT1, which are thought to act as molecular guidance cue in cellular migration, including axonal navigation at the ventral midline of the neural tube and projection of axons to different regions during neuronal development. ROBO2 also abrogates SLIT-ROBO signaling in vitro.

References
  • Brose K, et al. (1999) Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell. 96(6):795-806.
  • Brose K, et al. (1999) Slit2-Mediated chemorepulsion and collapse of developing forebrain axons. Neuron. 22(3):463-73.
  • Nagase T, et al. (2001) Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 7(4):273-81.
  • Size / Price
    Catalog: HG10310-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"