After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SOCS3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SOCS3cDNA Clone Product Information
Gene_bank_ref_id:NM_003955.3
cDNA Size:677
cDNA Description:ORF Clone of Homo sapiens suppressor of cytokine signaling 3 DNA.
Gene Synonym:CIS3, SSI3, ATOD4, Cish3, SSI-3, SOCS-3, MGC71791, SOCS3
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Suppressor of cytokine signaling 3, also known as SOCS-3, Cytokine-inducible SH2 protein 3, CIS-3, STAT-induced STAT inhibitor 3, SOCS3 and CIS3, is a protein which is widely expressed with high expression in heart, placenta, skeletal muscle, peripheral blood leukocytes, fetal and adult lung, and fetal liver and kidney. SOCS3 / CIS3 contains one SH2 domain and one SOCS box domain. SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS3 / CIS3 is involved in negative regulation of cytokines that signal through the JAK / STAT pathway. SOCS3 / CIS3 inhibits cytokine signal transduction by binding to tyrosine kinase receptors including gp130, LIF, erythropoietin, insulin, IL12, GCSF and leptin receptors. Binding to JAK2 inhibits its kinase activity. SOCS3 / CIS3 suppresses fetal liver erythropoiesis. It regulates onset and maintenance of allergic responses mediated by T-helper type 2 cells. SOCS3 / CIS3 regulates IL-6 signaling. SOCS3 / CIS3 interacts with multiple activated proteins of the tyrosine kinase signaling pathway including IGF1 receptor, insulin receptor and JAK2. SOCS3 / CIS3 could be used as a possible therapeutic agent for treating rheumatoid arthritis.

References
  • Hoertner M., et al., 2002, Eur. J. Biochem. 269:2516-26.
  • Yamamoto K., et al., 2003, Biochem. Biophys. Res. Commun. 310 : 1188-93.
  • Kamura T., et al., 2004, Genes Dev. 18:3055-65.
  • Okamura A., et al., 2004, Blood 103:2997-3004.
  • Ekelund E., et al., 2006, Am. J. Hum. Genet. 78:1060-5.
  • Size / Price
    Catalog:HG11315-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"