Quick Order

Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINA1cDNA Clone Product Information
Gene_bank_ref_id:NM_000295.4
cDNA Size:1257
cDNA Description:ORF Clone of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1, transcript variant 1 DNA.
Gene Synonym:PI, A1A, AAT, PI1, A1AT, MGC9222, PRO2275, MGC23330
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10306-ACG$325
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10306-ACR$325
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10306-CF$295
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10306-CH$295
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10306-CM$295
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10306-CY$295
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10306-M$95
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10306-M-N$295
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10306-NF$295
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10306-NH$295
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10306-NM$295
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10306-NY$295
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10306-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

SerpinA1, also known as Alpha-1 antitrypsin (AAT), is a prototype member of the Serpin superfamily of the serine protease inhibitors. This serine protease inhibitor blocks the protease, neutrophil elastase. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. SerpinA1 (alpha1-antitrypsin), an acute phase protein and the classical neutrophil elastase inhibitor, is localized within lipid rafts in primary human monocytes in vitro. It association with monocytes is inhibited by cholesterol depleting/efflux-stimulating agents (nystatin, filipin, MbetaCD (methyl-beta-cyclodextrin) and oxidized low-density lipoprotein (oxLDL) and conversely, enhanced by free cholesterol. Furthermore, SerpinA1/monocyte association per se depletes lipid raft cholesterol as characterized by the activation of extracellular signal-regulated kinase 2, formation of cytosolic lipid droplets, and a complete inhibition of oxLDL uptake by monocytes. Previous population studies have suggested that heterozygote status for the AAT gene (SerpinA1) is a risk factor for chronic rhinosinusitis with nasal polyposis (CRSwNP). Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SerpinA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin deficiency is an inherited disease affecting the lung and liver. In the liver, alpha-1 antitrypsin deficiency may manifest as benign neonatal hepatitis syndrome; a small percentage of adults develop liver fibrosis, with progression to cirrhosis and hepatocellular carcinoma. Its most important physiologic functions are the protection of pulmonary tissue from aggressive proteolytic enzymes and regulation of pulmonary immune processes.

References
  • Khnlein T, et al. (2008) Alpha-1 antitrypsin deficiency: pathogenesis, clinical presentation, diagnosis, and treatment. Am J Med. 121(1): 3-9.
  • Camelier AA, et al. (2008) Alpha-1 antitrypsin deficiency: diagnosis and treatment. J Bras Pneumol. 34(7): 514-27.
  • Subramaniyam D, et al. (2010) Cholesterol rich lipid raft microdomains are gateway for acute phase protein, SERPINA1. Int J Biochem Cell Biol. 42(9): 1562-70.
  • Kilty SJ, et al. (2010) Polymorphisms in the SERPINA1 (Alpha-1-Antitrypsin) gene are associated with severe chronic rhinosinusitis unresponsive to medical therapy. Am J Rhinol Allergy. 24(1): e4-9.
  • Size / Price
    Catalog:HG10306-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"